Science Homework Help

Georgia Military College DNA Sequence and Gene Regulation Discussion

  1. Using the following DNA sequence, come up with your own corresponding sequence after a 1) point mutation and 2) frameshift mutation. Also write out the corresponding RNA sequence:
    AGTAAACGTACCTGAGACGGG
  2. Explain how gene regulation in eukaryotes differs from gene regulation in prokaryotes.